View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_72 (Length: 249)
Name: NF9612_low_72
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 3917134 - 3917360
Alignment:
| Q |
11 |
cagagaaaatggatgaactcgaaaaattaa-tcaaatcaaactaaaaattatccaatatttttagttttggtcaaaaaccaaactgaattgaaggaaatt |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||| ||||||| |||||||| |||||||| |
|
|
| T |
3917134 |
cagagaaaatcgatgaactcgaaaaattaaatcaaatcgaactaaaaattatccaatatttttagttctggttaaaaaccgaactgaatcgaaggaaacc |
3917233 |
T |
 |
| Q |
110 |
gaacagattgttttgagagtattttctctatattctatatttttgtataagtttactttgtcatattttgatattctgcataacaaaagtaatatttttt |
209 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3917234 |
ggacagattgttttgagagtattttctttatattctatatttttgtataagtttactttgtcatattttgatattctgcataacaaaagtaatatttttt |
3917333 |
T |
 |
| Q |
210 |
agcttattgttaaaattgtctgtttat |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3917334 |
agcttattgttaaaattgtctgtttat |
3917360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University