View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_74 (Length: 248)
Name: NF9612_low_74
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_74 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 42 - 248
Target Start/End: Original strand, 41569968 - 41570174
Alignment:
| Q |
42 |
gcctcccgctcattcaacaccagcgccatgcgccagtacgatgaactcttcgatgacagcaacatcatggacgctgtttgtcgcccttccttttctggta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41569968 |
gcctcccgctcattcaacaccagcgccatgcgccagtacgatgaactcttcgatgacagcaacatcatggacgctgtttgtcgcccttccttttctggta |
41570067 |
T |
 |
| Q |
142 |
cttgttatcacttgtaaaattgtttcattctaaccctaacaaaaatataactattcaatttcaatctatattttgattaacaaatacttaactttatctt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41570068 |
cttgttatcacttgtaaaattgtttcattctaaccctaacaaaaatataactattcaatttcaatctatattttgattaacaaatacttaactttatttt |
41570167 |
T |
 |
| Q |
242 |
tctttcc |
248 |
Q |
| |
|
||||||| |
|
|
| T |
41570168 |
tctttcc |
41570174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 246482 - 246534
Alignment:
| Q |
45 |
tcccgctcattcaacaccagcgccatgcgccagtacgatgaactcttcgatga |
97 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||| || |||||| |
|
|
| T |
246482 |
tcccgttcattcaacaccaacgccatgcgccagtacgacgaacgctccgatga |
246534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Original strand, 98174 - 98216
Alignment:
| Q |
45 |
tcccgctcattcaacaccagcgccatgcgccagtacgatgaac |
87 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
98174 |
tcccgttcattcaacaccaacgccatgcgccagtacgacgaac |
98216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 83
Target Start/End: Original strand, 19769276 - 19769314
Alignment:
| Q |
45 |
tcccgctcattcaacaccagcgccatgcgccagtacgat |
83 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
19769276 |
tcccgttcattcaacaccaacgccatgcgccagtacgat |
19769314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University