View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_75 (Length: 243)
Name: NF9612_low_75
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 36416132 - 36415919
Alignment:
| Q |
12 |
agaagcaaaggaatgaacctggtattagagacatgaaacctacattggttcttaatagaatcacttattggcaaaggttgttggatagagctattggtac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416132 |
agaatcaaaggaatgaacctggtattagagacatgaaacctacattggttcttaatagaatcacttattggcaaaggttgttggatagagctattggtac |
36416033 |
T |
 |
| Q |
112 |
gagaccgactggagcggctaagaataatcgtttggttcagatttctctttatgctgttgtgcaagaaagttttgatctttacaaagatatctctgatggg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416032 |
gagaccgactggagcggctaagaataatcgtttggttcagatttctctttatgctgttgtgcaagaaagttttgatctttacaaagatatctctgatggg |
36415933 |
T |
 |
| Q |
212 |
cttggggttgtttt |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36415932 |
cttggggttgtttt |
36415919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University