View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9612_low_75 (Length: 243)

Name: NF9612_low_75
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9612_low_75
NF9612_low_75
[»] chr3 (1 HSPs)
chr3 (12-225)||(36415919-36416132)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 36416132 - 36415919
Alignment:
12 agaagcaaaggaatgaacctggtattagagacatgaaacctacattggttcttaatagaatcacttattggcaaaggttgttggatagagctattggtac 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36416132 agaatcaaaggaatgaacctggtattagagacatgaaacctacattggttcttaatagaatcacttattggcaaaggttgttggatagagctattggtac 36416033  T
112 gagaccgactggagcggctaagaataatcgtttggttcagatttctctttatgctgttgtgcaagaaagttttgatctttacaaagatatctctgatggg 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36416032 gagaccgactggagcggctaagaataatcgtttggttcagatttctctttatgctgttgtgcaagaaagttttgatctttacaaagatatctctgatggg 36415933  T
212 cttggggttgtttt 225  Q
    ||||||||||||||    
36415932 cttggggttgtttt 36415919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University