View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_81 (Length: 238)
Name: NF9612_low_81
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_81 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 49016567 - 49016779
Alignment:
| Q |
1 |
cgaaaaaccgttacttctgtagaccaggcaggatttataaggatgcaagggtttgtaggcgtgctgttaacaccaaagaagaaaaacataccaaggacga |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49016567 |
cgaaaaacagttacttctgtagaccaggcaggatttataaggatgcaagggtttgtaggcgtggtgttaacacctaagaagaaaaacataccaaggacga |
49016666 |
T |
|
| Q |
101 |
gctatgatagagtggcctgttgatggttatagcgaggcataatctccaagatttcacgacaatgtagttcataaatacatttcttaaattaaacacctgc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49016667 |
gctatgatagagtggcttgttgatggttatagcgaggcataatctccaagatttcacgacaatgtagttcataaatacatttcttaaattaaacacctgc |
49016766 |
T |
|
| Q |
201 |
tctcccttgttag |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49016767 |
tctcccttgttag |
49016779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 12 - 86
Target Start/End: Complemental strand, 490176 - 490102
Alignment:
| Q |
12 |
tacttctgtagaccaggcaggatttataaggatgcaagggtttgtaggcgtgctgttaacaccaaagaagaaaaa |
86 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||||||||||||||| | |||||| || ||||||||||| |
|
|
| T |
490176 |
tacttctgcagaccaggcagaatctataaggatgcaagggtttgtaggcttcatgttaaaacttaagaagaaaaa |
490102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University