View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_88 (Length: 228)
Name: NF9612_low_88
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 1767465 - 1767601
Alignment:
| Q |
22 |
gtggatttcgtgtaagctcagcaactatggaatgtaagttaagcagctaaataaactcgacaccgttactcaataatgtctctggtcaaaaactcaaaat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1767465 |
gtggatttcgtgtaagctcagcaactatggaatgtaagttaagcagctaaataaactcgacaccgttactcaataatgtctctgg--------tcaaaat |
1767556 |
T |
 |
| Q |
122 |
aatactactagtaatcctagcatttaatcacaacaataactatta |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767557 |
aatactactagtaatcctagcatttaatcacaacaataactatta |
1767601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 208
Target Start/End: Original strand, 1767903 - 1767940
Alignment:
| Q |
171 |
ttttttctttctctcttttgttagccttcacataaacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
1767903 |
ttttttctttctctcttttgttagccgtgacataaacc |
1767940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University