View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9612_low_94 (Length: 203)
Name: NF9612_low_94
Description: NF9612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9612_low_94 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 47127554 - 47127752
Alignment:
| Q |
1 |
tatatctcttaaaaatataaaaatgaatatgtcacttaagtaagctaccat----ttctaatttcaaattaaattacatttgattatcgactggttcgtt |
96 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47127554 |
tatatatcttacaaatataaaaatgaatatgtcacttaagtaagctaccatgcatttctaatttcaaattaaattacatttgattatcgactggttcttt |
47127653 |
T |
|
| Q |
97 |
ctttcttatccatccatccatcatgtttgtataggcatggcttacttatatatggagaagagcaaaaagacatgaaatagaaccagagatagccgatgaa |
196 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127654 |
ctt--------atccatccatcatgtttgtataggcatggcttacttatatatggagaagagcaaaaagacatgaaatagaaccagagatagccgatgag |
47127745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University