View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9613_low_13 (Length: 266)
Name: NF9613_low_13
Description: NF9613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9613_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 11190527 - 11190280
Alignment:
| Q |
1 |
atcattcctgaagtagtgacaaacagaatgataggtagaatggcattgtctgttgggattccattaagtgttggacttttgttctttccannnnnnnact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11190527 |
atcattcctgaagtagtgacaaacagaatgatagggagaatggcattgtctgttgggattccattaagtgttggacttttgttctttccatttttttact |
11190428 |
T |
 |
| Q |
101 |
atcttaaagttggtttgaaaattgatgtgccaaattgggttccatttcttgtgtctttcttcttttttgggtctgctcttttaggagtgagttatgggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11190427 |
atcttaaagttggtttgaaaattgatgtgccaaattgggttccatttcttgtgtctttcttcttttttgggtctgcacttttaggagtgagttatgggat |
11190328 |
T |
 |
| Q |
201 |
tgtttctgctagttgggatccattgagggaagggtcacttttgggatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11190327 |
tgtttctgctagttgggatccattgagggaagggtcacttttgggatg |
11190280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University