View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9613_low_16 (Length: 225)
Name: NF9613_low_16
Description: NF9613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9613_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 46 - 214
Target Start/End: Original strand, 43946856 - 43947024
Alignment:
| Q |
46 |
gttattccgtcggaggaggtggaacagaaattattgaagaagaagaagaataatgaagtaactgtgccgtgtttggctaaagaagaacttcgtcgattgc |
145 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
43946856 |
gttattccgtcggaggaggtggaacataaattattgaagaagaagaagaagaatgaagtaactgtgccgtgtttggagaaagaagaacttagtcgattgc |
43946955 |
T |
 |
| Q |
146 |
gaacaatgggaattcatctcaaggagaaaatcagtatcccaaaatctggcctcacgcgttctctgcttc |
214 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43946956 |
gaacaatgggaattcatctgaagcagaaaatcagtatcccaaaatctggcctcacgcgttctgtgcttc |
43947024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University