View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9615_low_14 (Length: 323)
Name: NF9615_low_14
Description: NF9615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9615_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 10 - 304
Target Start/End: Original strand, 18716203 - 18716497
Alignment:
| Q |
10 |
gtgttggtggggatcttatgaaaacaccaacgttgttgttgttgatgttttttgaggtataacaatcatgtttcaaaattccactttcttcaccaccatc |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18716203 |
gtgttggtggggatcttttgaaaacaccaacgttgttgttgttgatgttttttgaggtataacaatcatgtttcaaaattccactttcttcaccaccatc |
18716302 |
T |
 |
| Q |
110 |
ataaaaaaccttagttataggtttattagattcatcatggtaagtcacataagtgtaatcttctggacttccaacaagaatctcatttgcaaaatttcca |
209 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18716303 |
ataaaaaaccttagtgataggtttattagattcatcatggtaagtcacataagtgtaatcttctggacttccaacaagaatctcatttgcaaaatttcca |
18716402 |
T |
 |
| Q |
210 |
ttttgttgttgatgattttgaatcggaattgtgatcggttctcctgatcgatttgacttaggtgtacaaacatgttttggaacaacctcgtaccc |
304 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18716403 |
ttttgttggtgatgattttgaattggaattgtgatcggttctcctgattgattcgtcttaggtgtacaaacatgttttggaacaacctcgtaccc |
18716497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University