View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9615_low_17 (Length: 275)
Name: NF9615_low_17
Description: NF9615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9615_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 12 - 169
Target Start/End: Complemental strand, 42340671 - 42340515
Alignment:
| Q |
12 |
agacaaaaacagaaatgatttttgtacagccaatattagaaacttctgtgacaatattttaaacagttcaaataggtgattaattaacttaacaagtgcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42340671 |
agacaaaaacagaaatgatttttgtacagccaatattagaaacttctgtgacaatattttaaacagttgaaataggtgattaattaacttaacaagtgcc |
42340572 |
T |
 |
| Q |
112 |
gaaactcattaactcacaatgttggacactattaagtattaaccgcaattgactgttg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42340571 |
gaaactcattaactcacaatgttggacactatt-agtattaaccgcaattgactgttg |
42340515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 231 - 259
Target Start/End: Complemental strand, 42340463 - 42340435
Alignment:
| Q |
231 |
cctaattacccagtaggaatcccagtaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42340463 |
cctaattacccagtaggaatcccagtaat |
42340435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University