View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9615_low_25 (Length: 240)
Name: NF9615_low_25
Description: NF9615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9615_low_25 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 143 - 240
Target Start/End: Complemental strand, 8629284 - 8629187
Alignment:
| Q |
143 |
tatcttgcttgtgctgcaagctatcttttatgtcttgtttcttttgcttatttccttcattgtgcaataccaaaaatataatcaagacattgcaagac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8629284 |
tatcttgcttgtgctgcaagctatcttttatgtcttgtttcttttgcttatttcctgcattgtgcaataccaaaaatataatcaagacattgcaagac |
8629187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 112
Target Start/End: Complemental strand, 8629359 - 8629265
Alignment:
| Q |
18 |
gatcccaacccgcaatgcataacccacaagtttccgcaatatccagatggcgtctagcaatatgaaaaaaggatgaatcttgcttgtgctgcaag |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
8629359 |
gatcccaacccgcaatgcataaaacacaagtttccgtaatatccagatggcgtctagcaatatgaaaaaaggaggtatcttgcttgtgctgcaag |
8629265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University