View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9615_low_30 (Length: 203)
Name: NF9615_low_30
Description: NF9615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9615_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 31714698 - 31714528
Alignment:
| Q |
19 |
aacagtcataattaaaaaactatggaaatgaggacaaggctttacattgttccgaatttgaatgttcaatcataatggtttatggagtctannnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31714698 |
aacagtcataattaaataactatggaaatgaggacaaggctttacattgttccgaatttgaatgttcaatcataatggtttatggagtctatgtgtgtgt |
31714599 |
T |
|
| Q |
119 |
nnnnnnttggaattatattaggtgataatatacaatcataatgaatattgaattattaggattagaattat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31714598 |
gtgtgtttggaattatattaggtgataatatacaatcataatgaatgttgaattattaggattagaattat |
31714528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University