View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9616_high_11 (Length: 258)
Name: NF9616_high_11
Description: NF9616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9616_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 41288689 - 41288456
Alignment:
| Q |
18 |
aacaaaacatactctctactataagtacttagaatgcaatgtaggtgatggaagatttacctgtttgagtcaagtaaaacggcaaccaataaagaaaagt |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41288689 |
aacaaaacatactctctactataggtacttagaatgcaatgtaggtgatggaagatt-acctgtttgagtcaagtaaaacggcaaccaataaagaaaagt |
41288591 |
T |
|
| Q |
118 |
ataagcaacaagcttagcaaagaaaagacacaaagcaaaagtaataacccctggtatcatacaagcttcaagtaacccaatactcttccctctcccatcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41288590 |
ataagcaacaagcttagcaaagaaaagacacaaagcaaaagtaataacccctggtatcatacaagcttcaagtaacccaatactcttccctctcccatca |
41288491 |
T |
|
| Q |
218 |
ccaccatttccacttccactctttctctctgcttc |
252 |
Q |
| |
|
||||| |||||||||||||||| |||||| |||| |
|
|
| T |
41288490 |
ccaccctttccacttccactctccctctctccttc |
41288456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University