View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9616_low_39 (Length: 208)
Name: NF9616_low_39
Description: NF9616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9616_low_39 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 5636947 - 5637094
Alignment:
| Q |
18 |
gtaagatataatcctttatagtatttctttgtttaaaatcaagctttgaaaaatatcctagatgtttatagtgtagcactagtatacttgaatatttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5636947 |
gtaagatataatcctttatagtatttttttgtttaaaatcaagctttgaaaaatatcctacatgtttatagagtagcactagtatacttgaatatttgga |
5637046 |
T |
|
| Q |
118 |
aaattagtgnnnnnnnnnntgttcaaattgtcatggctgaaagtgcaga |
166 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5637047 |
aaattagtg-aaaaaaaaatgttcaaattgtcatggctgaaagtgcaga |
5637094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 50199512 - 50199457
Alignment:
| Q |
153 |
gctgaaagtgcagagtgtaattcttctgtgacttctgtttatgaatatcaatggcc |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50199512 |
gctgaaagtggagagtgtaattcttctgtgaattctgtttatgaatatcaatggcc |
50199457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University