View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9616_low_40 (Length: 204)
Name: NF9616_low_40
Description: NF9616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9616_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 37628893 - 37629060
Alignment:
| Q |
18 |
agaacactacaggaaatgcatggaacaaagattcaaggaattagtgtcttccaaagggctagaggctgttcaaactgaggtcaaagacatggactgggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628893 |
agaacactacaggaaatgcatggaacaaagattcaaggaattagtgtcttccaaagggctagaggctgttcaaactgaggtcaaagacatggactgggag |
37628992 |
T |
 |
| Q |
118 |
agtactttccatttgcgtcacctacctgagtcaaacatttcagagatccctgatctcagtgatgaata |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628993 |
agtactttccatttgcgtcacctacctgagtcaaacatttcagagatccctgatctcagtgatgaata |
37629060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 88 - 185
Target Start/End: Complemental strand, 36872469 - 36872372
Alignment:
| Q |
88 |
caaactgaggtcaaagacatggactgggagagtactttccatttgcgtcacctacctgagtcaaacatttcagagatccctgatctcagtgatgaata |
185 |
Q |
| |
|
||||||||||||||||| ||||| ||||| || || |||||| | |||||||| ||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36872469 |
caaactgaggtcaaagatatggattgggaaagcaccttccatgttcgtcacctccctgaatcaaacatttcagagatacctgatctcagtgatgaata |
36872372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University