View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9619_low_19 (Length: 240)
Name: NF9619_low_19
Description: NF9619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9619_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 62 - 225
Target Start/End: Original strand, 14362049 - 14362212
Alignment:
| Q |
62 |
ctctctcttagaaaagggggagggtgaaaatagagaaaagtcaaaacaatatgaaggagagattaaataggtaaacgagtgttttggagcaaaacaagga |
161 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14362049 |
ctctctcttggaaaagggggagggtgaaaatagagaaaagtcaaaacaatatgaaggagagattaaatcggtaaacgagtgttttggagcaaaacaagga |
14362148 |
T |
|
| Q |
162 |
gagtgtttaaataaagaatttacatgagaatttgcatcactaatatatatatggttgctcttct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14362149 |
gagtgtttaaataaagaatttacatgagaatttgcatcactaatatatatatggttgctcttct |
14362212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 14361989 - 14362024
Alignment:
| Q |
1 |
ctctttgattcatgcaaaggttgagaagccatggag |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361989 |
ctctttgattcatgcaaaggttgagaagccatggag |
14362024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University