View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9619_low_21 (Length: 230)
Name: NF9619_low_21
Description: NF9619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9619_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 10167830 - 10167754
Alignment:
| Q |
78 |
tagtgatcagatgaatagtgaagcaatggagggagggagaaaagtggtggtagtggaagagagaagtggcggtggtg |
154 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10167830 |
tagtgaacagatgaatagtgaagcaatggagggagggagagaagtggtggtggtggaagagagaagtggcggtggtg |
10167754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University