View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_16 (Length: 408)
Name: NF9620_low_16
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_16 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 15 - 390
Target Start/End: Original strand, 68572 - 68947
Alignment:
| Q |
15 |
aaaggtttctttctgctacctttgcagatttacctgctcctcaatggaattgggaacaaatgccatctgctcccgtgcctcgtttagatggttacgctat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
68572 |
aaaggtttctttctgctacctttgcagatttacctgctcctcaatggaattgggaacagatgccatctgctcctgtgcctcgtttagatggttacgctat |
68671 |
T |
 |
| Q |
115 |
tcagattctaaatttgttctatgtcttttccggatatgcaaatcttgaccatgttagttggttcttatttcgtcgaatacaataacaaccgtaattgtgt |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
68672 |
tcagattctaaatttgttttatgtcttttccggatatgccaatcttgatcatgttagttggttcttatttcgttgaatacaacaacaaccgtaattgtgt |
68771 |
T |
 |
| Q |
215 |
gacgaaagagcttaattgatgattttggtttcttacaatgcaggtgcactctcatgttgatgtgtatgatttcacgagtaataaatgggtagagaggttt |
314 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
68772 |
gacgaaagtgcttaattgatgattttggtttctaacattgcaggttcactctcatgttgatgtgtatgatttcacgagtaataaatgggtagagaggttt |
68871 |
T |
 |
| Q |
315 |
gatacaccaaaagaaatggctaattcacatttgggaattgcaactgatgggagaaggtacatatatatagtctctg |
390 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
68872 |
gatacaccaaaagaaatggcaaattcacatttgggaattgcaactgatgggaaaaggtacatatatattgtctctg |
68947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University