View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_28 (Length: 281)
Name: NF9620_low_28
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 9 - 267
Target Start/End: Complemental strand, 32381384 - 32381126
Alignment:
| Q |
9 |
agcagagaaggtggaaaactccgttatgcacttaacggtgtctcccatgtggatgccgaaacccctcttaaactcgcagaatactacaatgttgctgaga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32381384 |
agcagagaaggtggaaaactccgttatgcacttaacggtgtctcccatgtggataccgaaacccctcttaaactcgcagaatactacaatgttgctgaga |
32381285 |
T |
|
| Q |
109 |
aggttttcaagtatgacactattcctgacatgccagaaaaccttggaaccagtgttaccttggcacccaatgttcttaaattcgaacaccgtactttcat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32381284 |
aggttttcaagtatgacactattcctgacatgccagaaaaccttggaaccagtgttaccttggcacccaatgttcttaaattcaaacaccgtactttcat |
32381185 |
T |
|
| Q |
209 |
tgagatcgtttttgagaaccatgagaaaagcgtccagtcttataatttggatggatact |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32381184 |
tgagatcgtttttgagaaccatgagaaaagcgtccagtcttataatttggatggatact |
32381126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University