View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_30 (Length: 281)
Name: NF9620_low_30
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 50408362 - 50408620
Alignment:
| Q |
18 |
gattggtgtttcaatgttgatttataagcaaatttcactaccactaggacgacaatgactaggaaccgaaaaacaa-ttcaatccatttttgtgtctata |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
50408362 |
gattggtgtttgaatgttgatttataagcaaatttcactaccactaggacgacaatgactaggaaccgaaaaaaaaattcaatccatttttgtgtctata |
50408461 |
T |
|
| Q |
117 |
gtataggaccgctttctttttcaatacccatctttcactgtaatcatgtgataaatatagggaatcaattataatatctaattttggctatacatgaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50408462 |
gtataggaccgctttctttttcaatacccatctttcactgtactcatgtgataaatatagggaatcaattataatatctaattttggctatacatgaatg |
50408561 |
T |
|
| Q |
217 |
aattttgtgtattcaactttggcattttcttgcgtgcaacattttgctgtctctgctac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
50408562 |
aattttgtgtattcaactttggcattttcttgtgtccaacattttgctgtctcagctac |
50408620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University