View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_36 (Length: 252)
Name: NF9620_low_36
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 38982904 - 38983121
Alignment:
| Q |
18 |
tttggtgttgctgcgtgtaagtgtaacctccatggcagagtcgctctacacaagggggatcctccattgacaacattttcgttgaaacataagctttacg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| | |||||| ||||||| || |
|
|
| T |
38982904 |
tttggtgttgctgcgtgtaagtgtaacctccatggcagagtcgctctgcacaagggggatcctccattgacaacactttcatagaaacagaagctttccg |
38983003 |
T |
|
| Q |
118 |
gattgtggcttgatctgcacaattggaatcttacacctcttgataagggttttttcgagtttaacttcagttcaattgaagatatg--cagagtttgggc |
215 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
38983004 |
gattgtggcctgatatgcacaattggaatcttacacctcttggtaagggttttttcgactttaacttcagttcaattgaagacatgcacagagtttgggc |
38983103 |
T |
|
| Q |
216 |
attaagggtggtgaatat |
233 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
38983104 |
attgagggtggtgaatat |
38983121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University