View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_40 (Length: 250)
Name: NF9620_low_40
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 4198141 - 4198382
Alignment:
| Q |
1 |
ttttctaccgattaagaccataaaatgtccctctttagttaaaaacttaagttaaacattggatataaaatctttgcaacattaatgtccctaatctagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198141 |
ttttctaccgattaagaccataaaatgtccctctttagttaaaaacttaagttaaacattcgatataaaatctttgcaacattaatgtccctaatctagt |
4198240 |
T |
 |
| Q |
101 |
gcaagaaatttaacaaaggggccattaaactttaagtctgcatgtaagcaatttgggactagaaggattaatttacacaattaaagtggaatatggttag |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4198241 |
gcaagaaatttaacaaagggaccattaaactttaggtctgcatgtaagcaatttggaactaggaggattaatttacagaattaaagtggaatatggttag |
4198340 |
T |
 |
| Q |
201 |
ttttctcaacaaaacggcatcataaaacgtccattctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4198341 |
ttttctcaacaaaacggcatcataaaacgtccattctttgct |
4198382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University