View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_42 (Length: 241)
Name: NF9620_low_42
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45551240 - 45551019
Alignment:
| Q |
1 |
agagtgcaggagacttgtcaaatcagattatcccatacgggaaagccttcgacaataatggagggaaactaagaagggccgatctgtctatcaccaattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45551240 |
agagtgcaggagacttgtcaaatcagattatcccatacgggaaagccttcgacaataatggagggaaactaggaagggccgatctgtctatcaccaattc |
45551141 |
T |
|
| Q |
101 |
aattctgggtttccttcaccagattcaaaggggaggaatggatagaggaagcaacttggacaggcaactagcttcaactagccacaccctctctcttgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45551140 |
aattctgggtttccttcaccagattcaaagggaaggaatggatagaggaagcaacttggacaggcaactagcttcaactagccataccctctctcttgta |
45551041 |
T |
|
| Q |
201 |
cagataaatgagatatccaaag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45551040 |
cagataaatgagatatccaaag |
45551019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University