View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9620_low_43 (Length: 241)

Name: NF9620_low_43
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9620_low_43
NF9620_low_43
[»] chr8 (1 HSPs)
chr8 (1-222)||(45551019-45551240)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45551240 - 45551019
Alignment:
1 agagtgcaggagacttgtcaaatcagattatcccatacgggaaagccttcgacaataatggagggaaactaagaagggccgatctgtctatcaccaattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
45551240 agagtgcaggagacttgtcaaatcagattatcccatacgggaaagccttcgacaataatggagggaaactaggaagggccgatctgtctatcaccaattc 45551141  T
101 aattctgggtttccttcaccagattcaaaggggaggaatggatagaggaagcaacttggacaggcaactagcttcaactagccacaccctctctcttgta 200  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
45551140 aattctgggtttccttcaccagattcaaagggaaggaatggatagaggaagcaacttggacaggcaactagcttcaactagccataccctctctcttgta 45551041  T
201 cagataaatgagatatccaaag 222  Q
    ||||||||||||||||||||||    
45551040 cagataaatgagatatccaaag 45551019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University