View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9620_low_50 (Length: 209)
Name: NF9620_low_50
Description: NF9620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9620_low_50 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 29789984 - 29790192
Alignment:
| Q |
1 |
tgcatcttgccttccaacaccaacatagagtagttaagaagagcgtaactaaattcatcaaatcttgagtagcatgaagatcactccaaaggatcccaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789984 |
tgcatcttgccttccaacaccaacatagagtagttaagaagagcgtaactaaattcatcaaatcttgagtagcatgaagatcactccaaaggatcccaca |
29790083 |
T |
 |
| Q |
101 |
gaaaaaagttggagataatttagagtttaagtttgtggtttacttaacgcaatgatctttcacgttatagcattattcattcacgagataatgccaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29790084 |
gaaaaaagttggagataatttagagtttaagtttgtggtttacttaacgcaatgatctttcacgttatagcattattcattcacgagataatgccaaaaa |
29790183 |
T |
 |
| Q |
201 |
ctaattgtt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
29790184 |
ctaattgtt |
29790192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University