View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9621_high_14 (Length: 299)
Name: NF9621_high_14
Description: NF9621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9621_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 45379292 - 45379038
Alignment:
| Q |
19 |
aatgcgatatttattcgccacactaaaatgttaacacttctctcaactgaatgcgatatttaattcaccaagttattagagtttataaatatttagtaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45379292 |
aatgcgatatttattcgccacactaaaatgttaacacttctctcaactgaatgcgatatttaattcaccaagttattagagtttataaatatttagcaag |
45379193 |
T |
 |
| Q |
119 |
actcaaaactccctttgtaaaaataatgttataatttatgccaaacgaacaagg-nnnnnnncacagggttctggcagtgtccatgcaactacgtacaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379192 |
actcaaaactccctttgtaaaaataatgttataatttatgccaaacgaacaaggaaaaaaaacacagggttctggcagtgtccatgcaactacgtacaag |
45379093 |
T |
 |
| Q |
218 |
ccaactgtaaccaatggggatataaaattgatcaacactttgcaagtaaaattcc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379092 |
ccaactgtaaccaatggggatataaaattgatcaacactttgcaagtaaaattcc |
45379038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University