View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9621_high_17 (Length: 244)
Name: NF9621_high_17
Description: NF9621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9621_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 32260144 - 32259914
Alignment:
| Q |
1 |
cataaaaaacttttagaagtaatgataaaaccgtaaaagaagccatgaggggtaatattccaagtaggctagtactttttgctgctcttatagtcattag |
100 |
Q |
| |
|
||||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260144 |
cataaaaaactttcaggagtaatgataaaaccgaaaaagaagccatgaggggtaatattccaagtaggctagtactttttgctgctcttatagtcattag |
32260045 |
T |
|
| Q |
101 |
tagatccattttcagtgcaatcaagaacaaaaagtatatagctccgagtaatgacaacgctgataaaacatcagattgtcttgggggaaacaaggccttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260044 |
tagatccattttcagtgcaatcaagaacaaaaagtatatagctccgagtaatgacaacactgataaaacatcagattgtcttgggggaaacaaggccttc |
32259945 |
T |
|
| Q |
201 |
caataaatctcgttcctccctagaagtgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32259944 |
caataaatctcgttcctccctagaagtgatg |
32259914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University