View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9621_low_33 (Length: 295)
Name: NF9621_low_33
Description: NF9621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9621_low_33 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 79 - 295
Target Start/End: Complemental strand, 37108714 - 37108498
Alignment:
| Q |
79 |
atgtgtatggaagaaacaggaaactgattggggcaaggtatttcaacaaaggcgtcgcttctagactaactgttccactagactcatcttttgagacacc |
178 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |||||| | || || ||||| ||||| |
|
|
| T |
37108714 |
atgtatatggaaaaaacaggaaactgattggagcaaggtatttcaacaaaggctatgcttcgagactaactgtcccactaaattcttcctttgaaacacc |
37108615 |
T |
 |
| Q |
179 |
tcgtgacaatgaaggtcatggatctcatactttatcaacggccggtggaaacatggtacctggagtcagtgtcttcggtcaaggcaatggaacagcaaag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37108614 |
tcgtgacaatgaaggtcatggatctcatactttatcaacagccggtggaaacatggtacctggagtcagtgtcttcggtcaaggctatggaacagcaaag |
37108515 |
T |
 |
| Q |
279 |
ggtggttcaccaaaagc |
295 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37108514 |
ggtggttcaccaaaagc |
37108498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University