View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9621_low_36 (Length: 267)
Name: NF9621_low_36
Description: NF9621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9621_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 258
Target Start/End: Original strand, 7221432 - 7221669
Alignment:
| Q |
20 |
tggatgccatagtttgtgttgcattggacctatttataatattgcagtacatcaattacagataccatcgaaagacaacaacatcaagtgactatggtaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7221432 |
tggatgccatagtttgtgttgcattggacttatttataatattgcagtacatcaattacagataccatcgaaagacaacaacatcaagtgactatggtaa |
7221531 |
T |
|
| Q |
120 |
ttatcaagactacaaagaagccagaaaaactattgtttcttgattttgtggagttgtaacattaattttgatttgaacaaatattatattattctactaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7221532 |
ttatcaagactacaaagaagccagaaaaactattgtttcttga-tttgtggagttgtaacattattttttattttaacaaatattatattattctactaa |
7221630 |
T |
|
| Q |
220 |
cattcagctattagtgtttgagtcttggtgtagtattat |
258 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7221631 |
cattcagctattagtggttgagtcttggtgtagtattat |
7221669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University