View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9621_low_45 (Length: 240)
Name: NF9621_low_45
Description: NF9621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9621_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46373977 - 46373755
Alignment:
| Q |
1 |
tggtaaaatccacaccatgactctaatccctctccaagccgttgtggtcttcttatatcaggtgaaaagaaagacctcccaatggggcaatacctttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46373977 |
tggtaaaatccacaccatgactctaatccctctccaagccgttgtggtcttcttatatcaggtgaaaagaaagacctcccaatggggcaatacctttaga |
46373878 |
T |
|
| Q |
101 |
aattgaagtaattgtaagataaacaataacttaagcttcatactttcattctatatatcatttattggttcaaaatttcataaacacatgaatgactagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46373877 |
aattgaagtaattgtaagataaacaataacttaagcttcatactttcattctatatatcatttattggttcaaaatttcataaacacatgaatgactagt |
46373778 |
T |
|
| Q |
201 |
actacctcttagttgatagctct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46373777 |
actacctcttagttgatagctct |
46373755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 15408264 - 15408158
Alignment:
| Q |
1 |
tggtaaaatccacaccatgactctaatccctctccaagccgttgtggtcttcttatatcaggtgaaaagaaagacctcccaatggggcaatacctttaga |
100 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||| || ||||||||| ||| |||||||||||| | || |||||||| || || ||| ||||||||| |
|
|
| T |
15408264 |
tggtaaaatccacaccacgacttcaatccttctccgagtcgttgtggtgctctaatatcaggtgaataaaatgacctcccgataggacaaaacctttaga |
15408165 |
T |
|
| Q |
101 |
aattgaa |
107 |
Q |
| |
|
|| |||| |
|
|
| T |
15408164 |
aaatgaa |
15408158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University