View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9621_low_47 (Length: 239)
Name: NF9621_low_47
Description: NF9621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9621_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 21 - 224
Target Start/End: Original strand, 38241442 - 38241647
Alignment:
| Q |
21 |
tgcgaggaaaatctaacagttataagctggctaagnnnnnnn-caaattacgaaaacaaagcatcccaacgattactacattcattgtagcatgcaatca |
119 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
38241442 |
tgcgaggaaaatctaacagatttaagctgactaagcaaaaaaacaaattacgaaaacaaagcatcccaacgattactacgttcattgtagcacgcaatca |
38241541 |
T |
 |
| Q |
120 |
ctt-aacaaattgtgccattctccaatcacacatacaagactcaacctacataattatgcagatcactctaatgagagaccctgcacaaatcctttccca |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38241542 |
ctttaacaaattgtgccattctccaatcacacatacaagactcaacctacataattatgcagatcactctaatgagagaccctgcacaaatcctttccca |
38241641 |
T |
 |
| Q |
219 |
aaaact |
224 |
Q |
| |
|
|||||| |
|
|
| T |
38241642 |
aaaact |
38241647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University