View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9622_low_11 (Length: 318)
Name: NF9622_low_11
Description: NF9622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9622_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 9968177 - 9968481
Alignment:
| Q |
1 |
acaggattaacctcaattgaatcaacttctttctcaccaacaatttctaatgtctcatttgcaacagtcttagaagcagatggtgtagacttgaccctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9968177 |
acaggattaacctcaattgaatcaacttctttatcaccaacaatttctaatgtctcatttgcaacagtcttagaagcagatggtgtagacttgaccctgt |
9968276 |
T |
 |
| Q |
101 |
acgcaacagccttgactgctttccttccgaatttagcgccttggctgatgtttacagcacggttatcagcacccccatggtgtattgtccgcttcttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9968277 |
acgcaacagccttgactgctttccttccgaatttagcgccttggctgatgtttacagcacggttatcagcacccccatggtgtattgtccgcttcttcaa |
9968376 |
T |
 |
| Q |
201 |
gaaataatacttgctattctgattagcactctttaccgaagaatgttcagtgccaacttccacattcttctggtaactataaactttgccatgtgttgcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9968377 |
gaaataatacttgctattctgattagcactctttaccgaagaatgttcagtgccaacttccacattcttctggtaactataaactttgccatgtgttgcc |
9968476 |
T |
 |
| Q |
301 |
cgtct |
305 |
Q |
| |
|
||||| |
|
|
| T |
9968477 |
cgtct |
9968481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University