View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9622_low_14 (Length: 256)
Name: NF9622_low_14
Description: NF9622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9622_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 3640082 - 3640324
Alignment:
| Q |
1 |
tggtactgttggaagagcaaaagatggaaactaagctgctctcctcttatgcataagtccatgtaggggctcgaaccccgaacaccccaaaggtgaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
3640082 |
tggtactgttggaagagcaaaagatggaaactaagctgctctcctcttatgcataagtccatgtaggggctcgaaccctgaacactccaaaggtgaattt |
3640181 |
T |
|
| Q |
101 |
ctagtcagtaggttcagccacacctgtcacaccctcctctgcaactgagcgtaagccagccagaacaaaggctagagcgcgtgcttcaagaccatgatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3640182 |
ctagtcagtaggttcagccacacctgtcataccctcctctgcaactgagcgtaagccagccagaacaaaggctagagcgcgtgcttgaagaccatgatgg |
3640281 |
T |
|
| Q |
201 |
acagaccgtcatgagccatgacgcccgtcatggtgcccagtct |
243 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3640282 |
acagaccgtcatgagccgtgacgcccgtcatggtgcccagtct |
3640324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 203 - 245
Target Start/End: Original strand, 41153936 - 41153978
Alignment:
| Q |
203 |
agaccgtcatgagccatgacgcccgtcatggtgcccagtctct |
245 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
41153936 |
agaccgtcatcatccatgacgcccgtcatggtgcccagtctct |
41153978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University