View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_high_37 (Length: 217)
Name: NF9623_high_37
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 25 - 196
Target Start/End: Complemental strand, 54468684 - 54468515
Alignment:
| Q |
25 |
ttggagttgaagttgaagttggagatgatgttatgttacttgtgtcagatagatggt---agataatatgaagatannnnnnngtaccaagggcgtgttg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
54468684 |
ttggagttgaagttgaagttggagatgatgttatgttacttgtgtcagatagatgatgatagataatatgaagatatttttttgtaccaagggcgtgttg |
54468585 |
T |
 |
| Q |
122 |
gacaaaccaaagatcgagttaaagacacgaaccaaaccaaaccaacacaacactcggtgactcgaaacaccgttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54468584 |
gacaaaccaaagatcgagttaaagacacgaaccaaa-----ccaacacaacactcggtgactcgaaacaccgttt |
54468515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University