View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_49 (Length: 261)
Name: NF9623_low_49
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 4 - 247
Target Start/End: Original strand, 49168487 - 49168730
Alignment:
| Q |
4 |
ggagtagcagagaagaaggatgtgtacaagtgatcgggaaaaataatccagatatattgtgtccaagaaactaaattagccgcggtgtataggaaagttt |
103 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168487 |
ggagtagcaaaaaagaaggatgtgtacaagtgatcgggaaaaataatccagatatattgtgtccaagaaactaaattagccgcggtgtataggaaagttt |
49168586 |
T |
 |
| Q |
104 |
gcaaaattttgtgcggccaaggcatcagaggtaagatcaggaggactattggtgatttggaattataaaaatttaaaattacaatgtgaggctagagggg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168587 |
gcaaaattttgtgcggccaaggcatcagaggtaagatcaggaggactattagtgatttggaattataaaaatttaaaattacaatgtgaggctagagggg |
49168686 |
T |
 |
| Q |
204 |
atcattttatttgcttggatggattgtggggacaagaggaaact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168687 |
atcattttatttgcttggatggattgtggggacaagaggaaact |
49168730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University