View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_52 (Length: 254)
Name: NF9623_low_52
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 28319078 - 28318850
Alignment:
| Q |
20 |
tctttcaatttaattagttgctataatgtagtagtgtgaaaacttttaatgaagagctatgtctttcttgtggtttgccactttgtcctatcttacaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28319078 |
tctttcaatttaattagttgctataatgtagcagcgtgaaaacttttaatgaagagctatgtctttcttgtggtttgccactttgtcctatcttacaatt |
28318979 |
T |
 |
| Q |
120 |
aatttataccaaaatatgcatatagtaacatttataaatctgaacataattatatatacaatttaaagtcaattaaatatgtttgaattttcaaatattt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28318978 |
aatttataccaaaatatgcatatagtaacatttataaatctgaacataattatatgtacaatttaaagtcaattaaatatgtttgaattttcaaatattt |
28318879 |
T |
 |
| Q |
220 |
tggctgcatctatctccactaacaccaaa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28318878 |
tggctgcatctatctccactaacaccaaa |
28318850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University