View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_56 (Length: 251)
Name: NF9623_low_56
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 5549975 - 5549754
Alignment:
| Q |
15 |
aatcttcaacgttcagaggcaatcttgtggtggcaggaggtgaaaataggaaaaaataatcgctatagctgttcattattgtcggtatgttcccaaattt |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549975 |
aatcttcaacgttcagaggcaattttgtggtggcaggaggtgaaaataggaaaaaataatcgctatagctgttcattattgtcggtatgttcccaaattt |
5549876 |
T |
 |
| Q |
115 |
taccatgttgctaagaaaatcctgtctctagtacaattgattcacaccacatgttgatcgacaaaaacatgaaccgcatgtatcctttgatcggtagaat |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5549875 |
taccaggttgctaagaaaatcctgtctcta--acaaatgattcacaccacatgttgatcgacaaaaacatgaaccgcatgtatcctttgatcgatagaat |
5549778 |
T |
 |
| Q |
215 |
taagttatacataaaagagtagta |
238 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
5549777 |
taagttatagataaaagagtagta |
5549754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University