View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_62 (Length: 242)
Name: NF9623_low_62
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 9222234 - 9221996
Alignment:
| Q |
1 |
tttacgcgttagttaatcgtgtttgttttgattttaattatggttattggttaaggaaaccatggtcgcgatggtgtggttttgggtttgtctgcttgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||| |
|
|
| T |
9222234 |
tttacgcgttagttaatcgtgtttgttttgattttaattatggttattggttaaggaaaccatggtcgcgatagtgtgg-tttgtgtttgtctgcttgca |
9222136 |
T |
|
| Q |
101 |
ataattgtacttgtatgggattggtgtgatcgtctttcttgaataggagaannnnnnnnnnnnnnnngaccaaataattattcggattatttcaagtttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9222135 |
ataattgtacttgtatgggattggtgtgatcgtctttcttgaataggagaattttttggatttttttgaccaaataattattcggattatttcaagtttt |
9222036 |
T |
|
| Q |
201 |
gaatattaaactaacttatcttgtcaagttcttgtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222035 |
gaatattaaactaacttatcttgtcaagttcttgtctctg |
9221996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University