View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_66 (Length: 240)
Name: NF9623_low_66
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 2925576 - 2925377
Alignment:
| Q |
20 |
agggtaaaatataaacaaagatgcgaagatggtataggattaaattaaaacatggtaacataaccttttttgtaaggtcggattcatgctgcttcctaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2925576 |
agggtaaaatataaacaaagatgcgaagatggtataggattaaattaaaacatggtaacataaccttttttgtaaagtcggattcatgctgcttcctaag |
2925477 |
T |
 |
| Q |
120 |
attctctgatttcaaatcttatatattgacaaaatccccttttgnnnnnnnnngcattggaagcttatgttgtgttactctctactctgatgatgcataa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
2925476 |
attctctgatttcaaatcttatatattgacaaaatccccttttgtttttttttgcattggaagcttatgttatgttactctctactctcatgatgcataa |
2925377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University