View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_70 (Length: 239)
Name: NF9623_low_70
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 32896477 - 32896701
Alignment:
| Q |
1 |
cgtatgagacatattagtcgtatctcgattagttattaaactaaactcaatcgatacgaatttcttgnnnnnnnnnnnnntttgaacatgaatctcatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32896477 |
cgtatgagacatattagtcgtatctcgattagttattaaactaaactcaatcgatacgaatttcttgtatatatatattttttgaacatgaatctcatct |
32896576 |
T |
 |
| Q |
101 |
tgaaacttagtctattaattctaataaagcactgcctaaatttaatttaacttgtcaannnnnnnngtcaaccttttacttttgtcattaatttgttcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32896577 |
tgaaacttagtctattaattctaataaagcactgcctaaatttagtttaacttgtcaattttttttgtcaaccttttacttttgtcattaatttgttcta |
32896676 |
T |
 |
| Q |
201 |
ttattacttgaatatatgatgtatc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32896677 |
ttattacttgaatatatgatgtatc |
32896701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University