View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_78 (Length: 227)
Name: NF9623_low_78
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 44 - 221
Target Start/End: Complemental strand, 41703722 - 41703545
Alignment:
| Q |
44 |
aagaaaattttcttttgactctgtcaactgcattggcaaatttgctttcttgttgtgttgccagtgccactgatgaacatggatttgcggtgattccaga |
143 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41703722 |
aagaagattttcttttgactctgtcaactgcattggaaaatttgctttcttgttgtgttgccagtgccactgatgaacatggatttgcggtgattccaga |
41703623 |
T |
|
| Q |
144 |
acatgctttcttttcatgtactcctctagagatagattgatcatcgtcgttgtcatggtttatgatgtccatctcatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
41703622 |
acatgctttcttttcatgtactcctctagagatagattgatcatcgtcgttgtcatggtttatgatctcaatctcatt |
41703545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 41467393 - 41467496
Alignment:
| Q |
18 |
agaagtggaggtttcacagatgctggaagaaaattttcttttgactctgtcaactgcattggcaaatttgctttcttgttgtgttgccagtgccactgat |
117 |
Q |
| |
|
|||||| |||||||||| | |||| ||||||||||||||||||| |||||||||||||| |||||||||||| |||||| |||| ||| ||| ||||| |
|
|
| T |
41467393 |
agaagtcgaggtttcactgtcgctgaaagaaaattttcttttgacagtgtcaactgcattgccaaatttgcttttttgttgggttgtcagggcccctgat |
41467492 |
T |
|
| Q |
118 |
gaac |
121 |
Q |
| |
|
|||| |
|
|
| T |
41467493 |
gaac |
41467496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 106
Target Start/End: Original strand, 41513161 - 41513223
Alignment:
| Q |
44 |
aagaaaattttcttttgactctgtcaactgcattggcaaatttgctttcttgttgtgttgcca |
106 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
41513161 |
aagaaaattttcttttaacagtgtcaactgcattgggaaatttgcttttttgttgtgttgcca |
41513223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 98
Target Start/End: Original strand, 41506890 - 41506970
Alignment:
| Q |
18 |
agaagtggaggtttcacagatgctggaagaaaattttcttttgactctgtcaactgcattggcaaatttgctttcttgttg |
98 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||||||| ||||||||||||| ||||| ||| ||| |||||| |
|
|
| T |
41506890 |
agaagtggaggtttcactgtcgctgaaagaaaattttcttttgaccgtgtcaactgcatttgcaaacttggttttttgttg |
41506970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 106
Target Start/End: Original strand, 41522096 - 41522158
Alignment:
| Q |
44 |
aagaaaattttcttttgactctgtcaactgcattggcaaatttgctttcttgttgtgttgcca |
106 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
41522096 |
aagaaaattttcttttaaaagtgtcaactgcattgggaaatttgcttttttgttgtgttgcca |
41522158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 41497641 - 41497706
Alignment:
| Q |
18 |
agaagtggaggtttcacagatgctggaagaaaattttcttttgactctgtcaactgcattggcaaa |
83 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||||| ||| ||| ||||| ||||| |
|
|
| T |
41497641 |
agaagtggaggtttcactgtcgctgaaagaaaattttcttttgactgtgttaaccgcatttgcaaa |
41497706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University