View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_79 (Length: 224)
Name: NF9623_low_79
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 1217934 - 1218017
Alignment:
| Q |
16 |
agacagcacttcctcttttgttctcatgccaaattccaccactcagaatctcctctctttttcctctctcactctcaaatgtac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217934 |
agacagcacttcctcttttgttctcatgccaaattccaccactcagaatctcctctctttttcctctctcactctcaaatgtac |
1218017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 1218071 - 1218128
Alignment:
| Q |
153 |
acaaattcatggctttcaacatagctactatgttgccattttttctttcctttgtttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1218071 |
acaaattcatggctttcaacatagctactatgttgccattttttctttcctttgtttt |
1218128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University