View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9623_low_87 (Length: 211)
Name: NF9623_low_87
Description: NF9623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9623_low_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 14 - 162
Target Start/End: Original strand, 447744 - 447900
Alignment:
| Q |
14 |
cagagatacagttaaaagaatttaaaggaattttaacattaacaacaaggccaaatacacattagggtcc--------ttagagtttaaggtatgtaaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
447744 |
cagagatacagttaaaagaatttaaaggaattttaacattaacaacaaggccaaatacacattagggtccgggtgtccttagagtttaacgtatgtaaca |
447843 |
T |
 |
| Q |
106 |
gattagtccttttagtttcaaattgactttactaacttcctgacccattcgagatta |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
447844 |
gattagtccttttactttcaaattgactttactaacttcctgaccgattcgagatta |
447900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University