View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9625_low_11 (Length: 334)
Name: NF9625_low_11
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9625_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 35 - 321
Target Start/End: Complemental strand, 14361955 - 14361669
Alignment:
| Q |
35 |
tataggaattgcaattccaattgctctcacattgacaataatcatcctctttggatcaggcagaaagtacaatgtcttagccaaaccattttggtttgca |
134 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361955 |
tataggaattgcaattcccattgctctcacattgacaataatcatcctctttggatcaggcagaaagtacaatgtcttagccaaaccattttggtttgca |
14361856 |
T |
 |
| Q |
135 |
ccactttggtatattcatttagccacgttgggttcatctttcttcatgggtctagctgcatggttagtttgggctgatggtggatttcaaggtgaaacag |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361855 |
ccactttggtatattcatttagccacgttgggttcatctttcttcatgggtctagctgcttggttagtttgggctgatggtggatttcaaggtgaaacag |
14361756 |
T |
 |
| Q |
235 |
atgcattgtctttctatatagcacatgtctctctaagcattgtttggcatccacttgttcttgttatgaatgcttattggcttgcct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361755 |
atgcattgtctttctatatagcacatgtctctctaagcattgtttggcatccacttgttcttgttatgaatgcttattggcttgcct |
14361669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University