View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9625_low_20 (Length: 261)
Name: NF9625_low_20
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9625_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 6552935 - 6552706
Alignment:
| Q |
19 |
gtagattgcctttgatcaacctttaacctcttcatggtagtatcatttctgtttataccatggagagctgcatctgcagctctaaaatcgtaaaactcga |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6552935 |
gtagattgcatttgatcaacctttaacctcttcatggtagtatcatttctgtttataccatggagagctgcatctgcagctctaaaatcgtaaaactcga |
6552836 |
T |
|
| Q |
119 |
tcaacttgtgacgctgactgcgagggttttcatgaatctgcagttgttcagtaaggttcaccaatcacataaattatcttgatcaatatttctgtaacta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6552835 |
tcaacttgtgacgctgactgcgagggttttcatgaatctgcagttgttcagtaaggttcaccaatcacataaattatcttgatcaatatttctgtaacta |
6552736 |
T |
|
| Q |
219 |
acaaataaatttgtaaccaaaattacctct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6552735 |
acaaataaatttgtaaccaaaattacctct |
6552706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 49059946 - 49060138
Alignment:
| Q |
19 |
gtagattgcctttgatcaacctttaacctcttcatggtagtatcatttctgtttataccatggagagctgcatctgcagctctaaaatcgtaaaactcga |
118 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||||||| | ||||||||||| |||| | ||||||||||| ||||||||| ||||| |||||| || | |
|
|
| T |
49059946 |
gtagattggcttggctcaacctttaacctcttcatgcttgtatcatttctatttaaatcatggagagctttttctgcagcttcaaaattgtaaaattcaa |
49060045 |
T |
|
| Q |
119 |
tcaacttgtgacgctgactgcgagggttttcatgaatctgcagttgttcagtaaggttcaccaatcac--ataaattatcttgatcaatattt |
209 |
Q |
| |
|
||||||| ||| || |||| |||||||||||||||||||| ||| || ||||||||| |||| |||| |||||||||| | |||||||||| |
|
|
| T |
49060046 |
tcaacttatgatgccaactgtgagggttttcatgaatctgcggttattgagtaaggttaaccagtcacatataaattatcattatcaatattt |
49060138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University