View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9625_low_22 (Length: 259)
Name: NF9625_low_22
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9625_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 37926772 - 37927009
Alignment:
| Q |
9 |
acatcatcccaacccttttaccatttgactacacctaagatagttttctagggaaagtgactccaagttagttttcttggcattcaagtcacctaagata |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||| || ||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37926772 |
acatcatcccaactcttttaccatttgactacacctaaaatagttttcttggaaaactgactccatgttagttttcttggcattcaagtcacctaagata |
37926871 |
T |
 |
| Q |
109 |
--tccttggtgtcttaggaatagatgagataactgtttgcatcttttgtctagatttaggttttatgtgtctcatatttatagggaaggtaatcattatg |
206 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37926872 |
gttcattggtgtcttaggaatagatgagataattgtttgcatattttgtctagatttaggtttcatgtgtctcatatttatagggaaggtaatcattatg |
37926971 |
T |
 |
| Q |
207 |
cagaccaattggttggcattgggttgactctttctaca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37926972 |
cagaccaattggttggcattgggttgactctttctaca |
37927009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University