View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9625_low_22 (Length: 259)

Name: NF9625_low_22
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9625_low_22
NF9625_low_22
[»] chr5 (1 HSPs)
chr5 (9-244)||(37926772-37927009)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 37926772 - 37927009
Alignment:
9 acatcatcccaacccttttaccatttgactacacctaagatagttttctagggaaagtgactccaagttagttttcttggcattcaagtcacctaagata 108  Q
    ||||||||||||| |||||||||||||||||||||||| |||||||||| || ||| |||||||| ||||||||||||||||||||||||||||||||||    
37926772 acatcatcccaactcttttaccatttgactacacctaaaatagttttcttggaaaactgactccatgttagttttcttggcattcaagtcacctaagata 37926871  T
109 --tccttggtgtcttaggaatagatgagataactgtttgcatcttttgtctagatttaggttttatgtgtctcatatttatagggaaggtaatcattatg 206  Q
      || ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
37926872 gttcattggtgtcttaggaatagatgagataattgtttgcatattttgtctagatttaggtttcatgtgtctcatatttatagggaaggtaatcattatg 37926971  T
207 cagaccaattggttggcattgggttgactctttctaca 244  Q
    ||||||||||||||||||||||||||||||||||||||    
37926972 cagaccaattggttggcattgggttgactctttctaca 37927009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University