View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9625_low_26 (Length: 218)
Name: NF9625_low_26
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9625_low_26 |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0366 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 76 - 200
Target Start/End: Original strand, 8728 - 8852
Alignment:
| Q |
76 |
agttctaaatcacggtctgcaattgcattgtggcggcagtgtagaggttttaaacgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8728 |
agttctaaatcacggtctgcaattgcattgtggcggcagtgtagaggttttaaacgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
8827 |
T |
 |
| Q |
176 |
gtcgcaatattaaaattctcaaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8828 |
gtcgcaatattaaaattctcaaagt |
8852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 76 - 200
Target Start/End: Original strand, 8804 - 8928
Alignment:
| Q |
76 |
agttctaaatcacggtctgcaattgcattgtggcggcagtgtagaggttttaaacgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8804 |
agttctaaatcacggtctgcaattgcattgtggcgacagtgtagaggttttaaatgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
8903 |
T |
 |
| Q |
176 |
gtcgcaatattaaaattctcaaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8904 |
gtcgcaatattaaaattctcaaagt |
8928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University