View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9625_low_30 (Length: 217)

Name: NF9625_low_30
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9625_low_30
NF9625_low_30
[»] chr7 (1 HSPs)
chr7 (10-203)||(1268037-1268230)
[»] chr6 (1 HSPs)
chr6 (20-198)||(6973076-6973251)
[»] chr1 (1 HSPs)
chr1 (125-165)||(38292729-38292769)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 1268037 - 1268230
Alignment:
10 aagcagagaagattgtgttgagattggaagaagcaattcttatgggaatgatttattgggtatactattgaatgagatgcaaaagaaggaaactagttta 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1268037 aagcagaaaagattgtgttgagattggaagaagcaattcttatgggaatgatttattgggtatactattgaatgagatgcaaaagaaggaaactagttta 1268136  T
110 aatttgcaattagtgatggatgaatgcaaaacatttttcttttctggtcatgaaacaacagcgcttttactcacttggacagttatgttactag 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1268137 aatttgcaattagtgatggatgaatgcaaaacatttttcttttctggtcatgaaacaacagcgcttttactcacttggacagttatgttactag 1268230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 6973076 - 6973251
Alignment:
20 gattgtgttgagattggaagaagcaattcttatgggaatgatttattgggtatactattgaatgagatgcaaaagaaggaaactagtttaaatttgcaat 119  Q
    |||||||| || || || |||||||| ||||||||||||||||||||||| ||  | ||  ||||||| |||||||  | ||   | |||||  | ||||    
6973076 gattgtgtggaaataggtagaagcaaatcttatgggaatgatttattgggaatgttgttagatgagatacaaaagagtggaa---gcttaaacctacaat 6973172  T
120 tagtgatggatgaatgcaaaacatttttcttttctggtcatgaaacaacagcgcttttactcacttggacagttatgtt 198  Q
    |||| |||||||||||||||||||| |||||| |||| ||||||||||| || || |||||||| ||||| | ||||||    
6973173 tagttatggatgaatgcaaaacattcttctttgctggacatgaaacaactgcactcttactcacatggactgctatgtt 6973251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 165
Target Start/End: Complemental strand, 38292769 - 38292729
Alignment:
125 atggatgaatgcaaaacatttttcttttctggtcatgaaac 165  Q
    |||||||||||||| || ||||||||| |||||||||||||    
38292769 atggatgaatgcaagacctttttctttgctggtcatgaaac 38292729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University