View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9625_low_32 (Length: 217)
Name: NF9625_low_32
Description: NF9625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9625_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 2408868 - 2408686
Alignment:
| Q |
18 |
agaacagtatacatcacttcttcttccttgccgtcacaagcttgcaactctttattcccctttggatttctatttctcaaaaccctaaaatgcagggacg |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2408868 |
agaacattatacatcacttcttcttccttgccgtcacaagcttgcaactctttattcccctttggatttctatttctcaaaaccctaaaatgcaggggcg |
2408769 |
T |
|
| Q |
118 |
aaaataaaaaggatgtttttggggaaaaaaccaattgccacgtgtgactcaatcacttcaatctcacatccccttcattttaca |
201 |
Q |
| |
|
||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2408768 |
aaaat-aaaaggatgttttgggggaaaaaattgattgccacgtgtgactcaatcacttcaatctcacatccccttcattttaca |
2408686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 2412328 - 2412147
Alignment:
| Q |
19 |
gaacagtatacatcacttcttcttccttgccgtcacaagcttgcaactctttattcccctttggatttctatttctcaaaaccctaaaatgcagggacga |
118 |
Q |
| |
|
||||| || |||||| ||||||||||| || ||||||||| ||||||||||||||||||||| | | ||||||||| ||||||||||||||||||| | |
|
|
| T |
2412328 |
gaacaataaacatcatttcttcttcctcaccatcacaagctcgcaactctttattcccctttgactctttatttctcataaccctaaaatgcagggacaa |
2412229 |
T |
|
| Q |
119 |
aaataaaaaggatgtttttggggaaaaaaccaattgccacgtgtgactcaatcacttcaatctcacatccccttcattttaca |
201 |
Q |
| |
|
|||| |||| |||||| ||||||| ||| |||||||| |||||||| ||| | | |||||||||||||||||||||||| |
|
|
| T |
2412228 |
aaatgaaaaatgggttttt-gggaaaataccgattgccacatgtgactcgatcgcctacatctcacatccccttcattttaca |
2412147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University