View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9626_high_5 (Length: 249)
Name: NF9626_high_5
Description: NF9626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9626_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 53756321 - 53756088
Alignment:
| Q |
1 |
ccagtacacatcactcccttctcttcttccaccgcacctccctaatcatttctgacccctcccccacctcttttaaaagnnnnnnnnnnnnnnnnnncaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53756321 |
ccagtacacatcactcccttctcttcttccaccgcacctccctaatcatttctgacccctcccccacctcttttaaaagtctctttctctctctc--caa |
53756224 |
T |
 |
| Q |
101 |
ttaaacattacaactatttagagttagcattgccgcgtagagaggcaaaagagtttttgttagttaagtgtgtgggagcaaaatgactctcaatttagct |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53756223 |
ttaaacattacaactatttagagtaagcattgccgcgtagagaggcaaaagattttttgttagttaagtgtgtgggagcaaaatgactctcaatttagct |
53756124 |
T |
 |
| Q |
201 |
gctgttggagccttgcttctatgtgttgctccttct |
236 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| |
|
|
| T |
53756123 |
gctgttggagccttgcttctatgtgtttctacttct |
53756088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University